U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

ERX2160833: AB 3730xL Genetic Analyzer sequencing
1 CAPILLARY (AB 3730xL Genetic Analyzer) run: 1 spots, 779 bases, 27,741b downloads

Submitted by: Beijing Genomics Institute, Shenzhen
Study: 16S rDNA Sanger sequencing of LAB isolates
PRJEB21368 • ERP023611 • All experiments • All runs
show Abstracthide Abstract
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’; 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).
Sample: BF51
SAMEA104222235 • ERS1881253 • All experiments • All runs
Organism: Enterococcus xiangfangensis
Library:
Name: unspecified
Instrument: AB 3730xL Genetic Analyzer
Strategy: AMPLICON
Source: GENOMIC
Selection: PCR
Layout: SINGLE
Runs: 1 run, 1 spots, 779 bases, 27,741b
Run# of Spots# of BasesSizePublished
ERR2103547177927,741b2017-08-25

ID:
4425739

Supplemental Content

Related information

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...